m13 forward and reverse primers Search Results


90
Pharmacia LKB Biotechnology Inc m13 universal and reverse sequencing primers labeled with cy5
M13 Universal And Reverse Sequencing Primers Labeled With Cy5, supplied by Pharmacia LKB Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+universal+and+reverse+sequencing+primers+labeled+with+cy5/10__1128_slash_iai__68__3__1587___1599__2000-56-9-18
Average 90 stars, based on 1 article reviews
m13 universal and reverse sequencing primers labeled with cy5 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SoftGenetics m13-tagged lipa amplification primers (forward: 5′-tgctttgaagggcaaaatac-3′; reverse: 5′-tttctatttggaaagggtttgc-3′)
M13 Tagged Lipa Amplification Primers (Forward: 5′ Tgctttgaagggcaaaatac 3′; Reverse: 5′ Tttctatttggaaagggtttgc 3′), supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+tagged+lipa+amplification+primers++forward++5++tgctttgaagggcaaaatac+3+++reverse++5++tttctatttggaaagggtttgc+3++/pmc03690149-66-10-25
Average 90 stars, based on 1 article reviews
m13-tagged lipa amplification primers (forward: 5′-tgctttgaagggcaaaatac-3′; reverse: 5′-tttctatttggaaagggtttgc-3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
4base lab GmbH standard primers m13 universal and reverse, t3, and t7
Standard Primers M13 Universal And Reverse, T3, And T7, supplied by 4base lab GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/standard+primers+m13+universal+and+reverse++t3++and+t7/10__1128_slash_jb__188__7__2666___2673__2006-47-22-5
Average 90 stars, based on 1 article reviews
standard primers m13 universal and reverse, t3, and t7 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Pharmacia LKB Biotechnology Inc fluorescently labeled m13 reverse and forward (-20) primers
Fluorescently Labeled M13 Reverse And Forward ( 20) Primers, supplied by Pharmacia LKB Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/fluorescently+labeled+m13+reverse+and+forward+++20++primers/pmc00539256-207-15-31
Average 90 stars, based on 1 article reviews
fluorescently labeled m13 reverse and forward (-20) primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega vector-specific primers m13 forward m13 reverse
Vector Specific Primers M13 Forward M13 Reverse, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/vector+specific+primers+m13+forward+m13+reverse/pmc01472391-160-8-14
Average 90 stars, based on 1 article reviews
vector-specific primers m13 forward m13 reverse - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SibEnzyme ltd forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)
Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/forward+and+reverse+m13+primers++f++50+gttttcccagtcacgacgttg+30+and+r++50+tg+agcggataacaatttcacacag+30+/pm21476042-76-15-34
Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GeneWorks m13 universal forward and reverse primers
M13 Universal Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+universal+forward+and+reverse+primers/pmc03575496-104-15-16
Average 90 stars, based on 1 article reviews
m13 universal forward and reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
AgriGenome Labs m13 forward and reverse primers
M13 Forward And Reverse Primers, supplied by AgriGenome Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+and+reverse+primers/10__1186_slash_s41938___019___0164___2-58-28-30
Average 90 stars, based on 1 article reviews
m13 forward and reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Metabion International AG m13 forward or reverse primer labeled with fluorescent 5′-irdye700 or 5′-irdye800
M13 Forward Or Reverse Primer Labeled With Fluorescent 5′ Irdye700 Or 5′ Irdye800, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+or+reverse+primer+labeled+with+fluorescent+5++irdye700+or+5++irdye800/pmc04435468-98-67-68
Average 90 stars, based on 1 article reviews
m13 forward or reverse primer labeled with fluorescent 5′-irdye700 or 5′-irdye800 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega m13 lacz forward reverse primers
M13 Lacz Forward Reverse Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+lacz+forward+reverse+primers/pm10480921-64-27-36
Average 90 stars, based on 1 article reviews
m13 lacz forward reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag primer m13
Primer M13, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+1433r+1433f++m13+reverse+primer+pairs/pmc10172870-84-23-27
Average 90 stars, based on 1 article reviews
primer m13 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Bioarray Inc m13 forward (−20) 13 reverse primers
M13 Forward (−20) 13 Reverse Primers, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+++20++13+reverse+primers/pm24813267-88-14-27
Average 90 stars, based on 1 article reviews
m13 forward (−20) 13 reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results