90
|
Pharmacia LKB Biotechnology Inc
m13 universal and reverse sequencing primers labeled with cy5 M13 Universal And Reverse Sequencing Primers Labeled With Cy5, supplied by Pharmacia LKB Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+universal+and+reverse+sequencing+primers+labeled+with+cy5/10__1128_slash_iai__68__3__1587___1599__2000-56-9-18 Average 90 stars, based on 1 article reviews
m13 universal and reverse sequencing primers labeled with cy5 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
SoftGenetics
m13-tagged lipa amplification primers (forward: 5′-tgctttgaagggcaaaatac-3′; reverse: 5′-tttctatttggaaagggtttgc-3′) M13 Tagged Lipa Amplification Primers (Forward: 5′ Tgctttgaagggcaaaatac 3′; Reverse: 5′ Tttctatttggaaagggtttgc 3′), supplied by SoftGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+tagged+lipa+amplification+primers++forward++5++tgctttgaagggcaaaatac+3+++reverse++5++tttctatttggaaagggtttgc+3++/pmc03690149-66-10-25 Average 90 stars, based on 1 article reviews
m13-tagged lipa amplification primers (forward: 5′-tgctttgaagggcaaaatac-3′; reverse: 5′-tttctatttggaaagggtttgc-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
4base lab GmbH
standard primers m13 universal and reverse, t3, and t7 Standard Primers M13 Universal And Reverse, T3, And T7, supplied by 4base lab GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/standard+primers+m13+universal+and+reverse++t3++and+t7/10__1128_slash_jb__188__7__2666___2673__2006-47-22-5 Average 90 stars, based on 1 article reviews
standard primers m13 universal and reverse, t3, and t7 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Pharmacia LKB Biotechnology Inc
fluorescently labeled m13 reverse and forward (-20) primers Fluorescently Labeled M13 Reverse And Forward ( 20) Primers, supplied by Pharmacia LKB Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/fluorescently+labeled+m13+reverse+and+forward+++20++primers/pmc00539256-207-15-31 Average 90 stars, based on 1 article reviews
fluorescently labeled m13 reverse and forward (-20) primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
vector-specific primers m13 forward m13 reverse Vector Specific Primers M13 Forward M13 Reverse, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/vector+specific+primers+m13+forward+m13+reverse/pmc01472391-160-8-14 Average 90 stars, based on 1 article reviews
vector-specific primers m13 forward m13 reverse - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
SibEnzyme ltd
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/forward+and+reverse+m13+primers++f++50+gttttcccagtcacgacgttg+30+and+r++50+tg+agcggataacaatttcacacag+30+/pm21476042-76-15-34 Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
m13 universal forward and reverse primers M13 Universal Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+universal+forward+and+reverse+primers/pmc03575496-104-15-16 Average 90 stars, based on 1 article reviews
m13 universal forward and reverse primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
AgriGenome Labs
m13 forward and reverse primers M13 Forward And Reverse Primers, supplied by AgriGenome Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+and+reverse+primers/10__1186_slash_s41938___019___0164___2-58-28-30 Average 90 stars, based on 1 article reviews
m13 forward and reverse primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
m13 forward or reverse primer labeled with fluorescent 5′-irdye700 or 5′-irdye800 M13 Forward Or Reverse Primer Labeled With Fluorescent 5′ Irdye700 Or 5′ Irdye800, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+or+reverse+primer+labeled+with+fluorescent+5++irdye700+or+5++irdye800/pmc04435468-98-67-68 Average 90 stars, based on 1 article reviews
m13 forward or reverse primer labeled with fluorescent 5′-irdye700 or 5′-irdye800 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
m13 lacz forward reverse primers M13 Lacz Forward Reverse Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+lacz+forward+reverse+primers/pm10480921-64-27-36 Average 90 stars, based on 1 article reviews
m13 lacz forward reverse primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
primer m13 Primer M13, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+1433r+1433f++m13+reverse+primer+pairs/pmc10172870-84-23-27 Average 90 stars, based on 1 article reviews
primer m13 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Bioarray Inc
m13 forward (−20) 13 reverse primers M13 Forward (−20) 13 Reverse Primers, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+and+reverse+primers/m13+forward+++20++13+reverse+primers/pm24813267-88-14-27 Average 90 stars, based on 1 article reviews
m13 forward (−20) 13 reverse primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |